concentration − response curve fit (four parameters) using graphpad prism Search Results


pcmv6 entry mouse mlh1 origene  (OriGene)
90
OriGene pcmv6 entry mouse mlh1 origene
Figure 1. <t>MLH1</t> Deficiency Activates Innate Immune Signaling Pathway (A) Detection of cytosolic DNA in WT, Mlh1/ 4T1, and Mlh1-rescued (Rescd) 4T1 cells treated with or without IR, as indicated. DNA was detected using the PicoGreen fluorescence dye selectively binding dsDNA. Arrows point to cytosolic DNA. The scale bars are 10 mm. (B) Percentage of cells displaying cytosolic DNA with and without IR treatment. (C) Western blot analysis showing prolonged gH2AX in Mlh1/, but not in WT and Mlh1-rescued 4T1 cells after IR treatment. (D) Quantification of relative gH2AX levels in various 4T1 cells. (E) Increased production of cGAMP in Mlh1/ 4T1 cells. (F) Western blots showing enhanced phosphorylation of STING (pSTING) and STAT1 (pSTAT1) induced by IR in Mlh1/ cells. (G and H) Quantification of relative levels of pSTING (G) and pSTAT1 (H). (I) qRT-PCR analysis showing increased production of Isg15 in Mlh1/ cells. (J and K) Western blots (J) and qRT-PCR (K) showing that immune signaling induced by MLH1 deficiency depends on cGAS. When present, ‘‘’’ indicates untreated cells. Data represent the mean ± SEM of three independent experiments (B, D, G, and H) or three replicates (E, I, and K). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S1.
Pcmv6 Entry Mouse Mlh1 Origene, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+%E2%88%92+response+curve+fit+(four+parameters)+using+graphpad+prism/Mlh1+(NM_026810)+Mouse+Tagged+ORF+Clone+Lentiviral+Particle/pm33338427-205-151-153
Average 90 stars, based on 1 article reviews
pcmv6 entry mouse mlh1 origene - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
concentrators mwco 30kd vwr 95056 130 vivaspin 20  (Addgene inc)
90
Addgene inc concentrators mwco 30kd vwr 95056 130 vivaspin 20
KEY RESOURCES TABLE
Concentrators Mwco 30kd Vwr 95056 130 Vivaspin 20, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+%E2%88%92+response+curve+fit+(four+parameters)+using+graphpad+prism/BKK27720+(Bacterial+strain+%2395056)/pmc07104911-538-59-44
Average 90 stars, based on 1 article reviews
concentrators mwco 30kd vwr 95056 130 vivaspin 20 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
human lung fibroblast mrc 5 cell line  (ATCC)
99
ATCC human lung fibroblast mrc 5 cell line
KEY RESOURCES TABLE
Human Lung Fibroblast Mrc 5 Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+%E2%88%92+response+curve+fit+(four+parameters)+using+graphpad+prism/MRC-5/10__3390_slash_app11198908-279-19-28
Average 99 stars, based on 1 article reviews
human lung fibroblast mrc 5 cell line - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
kanamycin  (Thermo Fisher)
98
Thermo Fisher kanamycin
KEY RESOURCES TABLE
Kanamycin, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+%E2%88%92+response+curve+fit+(four+parameters)+using+graphpad+prism/KANAMYCIN+SULFATE/pm39870966-291-12-27
Average 98 stars, based on 1 article reviews
kanamycin - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier
analyte concentrations  (DiaSorin Biotechnology)
99
DiaSorin Biotechnology analyte concentrations
KEY RESOURCES TABLE
Analyte Concentrations, supplied by DiaSorin Biotechnology, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+%E2%88%92+response+curve+fit+(four+parameters)+using+graphpad+prism/FLEXMAP+3D+System/pm40141187-253-1-7
Average 99 stars, based on 1 article reviews
analyte concentrations - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
imarktm microplate absorbance reader  (Bio-Rad)
97
Bio-Rad imarktm microplate absorbance reader
KEY RESOURCES TABLE
Imarktm Microplate Absorbance Reader, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+%E2%88%92+response+curve+fit+(four+parameters)+using+graphpad+prism/iMark+Microplate+Absorbance+Reader/pmc07195489__41467_2020_16079_MOESM3_ESM-21-10-23
Average 97 stars, based on 1 article reviews
imarktm microplate absorbance reader - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier
pcmv6 entry mouse mlh1 origene  (Addgene inc)
96
Addgene inc pcmv6 entry mouse mlh1 origene
Figure 1. <t>MLH1</t> Deficiency Activates Innate Immune Signaling Pathway (A) Detection of cytosolic DNA in WT, Mlh1/ 4T1, and Mlh1-rescued (Rescd) 4T1 cells treated with or without IR, as indicated. DNA was detected using the PicoGreen fluorescence dye selectively binding dsDNA. Arrows point to cytosolic DNA. The scale bars are 10 mm. (B) Percentage of cells displaying cytosolic DNA with and without IR treatment. (C) Western blot analysis showing prolonged gH2AX in Mlh1/, but not in WT and Mlh1-rescued 4T1 cells after IR treatment. (D) Quantification of relative gH2AX levels in various 4T1 cells. (E) Increased production of cGAMP in Mlh1/ 4T1 cells. (F) Western blots showing enhanced phosphorylation of STING (pSTING) and STAT1 (pSTAT1) induced by IR in Mlh1/ cells. (G and H) Quantification of relative levels of pSTING (G) and pSTAT1 (H). (I) qRT-PCR analysis showing increased production of Isg15 in Mlh1/ cells. (J and K) Western blots (J) and qRT-PCR (K) showing that immune signaling induced by MLH1 deficiency depends on cGAS. When present, ‘‘’’ indicates untreated cells. Data represent the mean ± SEM of three independent experiments (B, D, G, and H) or three replicates (E, I, and K). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S1.
Pcmv6 Entry Mouse Mlh1 Origene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+%E2%88%92+response+curve+fit+(four+parameters)+using+graphpad+prism/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/pm33338427-205-151-147
Average 96 stars, based on 1 article reviews
pcmv6 entry mouse mlh1 origene - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier
logistic (hill) equations  (IDrug GmbH)
90
IDrug GmbH logistic (hill) equations
Figure 1. <t>MLH1</t> Deficiency Activates Innate Immune Signaling Pathway (A) Detection of cytosolic DNA in WT, Mlh1/ 4T1, and Mlh1-rescued (Rescd) 4T1 cells treated with or without IR, as indicated. DNA was detected using the PicoGreen fluorescence dye selectively binding dsDNA. Arrows point to cytosolic DNA. The scale bars are 10 mm. (B) Percentage of cells displaying cytosolic DNA with and without IR treatment. (C) Western blot analysis showing prolonged gH2AX in Mlh1/, but not in WT and Mlh1-rescued 4T1 cells after IR treatment. (D) Quantification of relative gH2AX levels in various 4T1 cells. (E) Increased production of cGAMP in Mlh1/ 4T1 cells. (F) Western blots showing enhanced phosphorylation of STING (pSTING) and STAT1 (pSTAT1) induced by IR in Mlh1/ cells. (G and H) Quantification of relative levels of pSTING (G) and pSTAT1 (H). (I) qRT-PCR analysis showing increased production of Isg15 in Mlh1/ cells. (J and K) Western blots (J) and qRT-PCR (K) showing that immune signaling induced by MLH1 deficiency depends on cGAS. When present, ‘‘’’ indicates untreated cells. Data represent the mean ± SEM of three independent experiments (B, D, G, and H) or three replicates (E, I, and K). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S1.
Logistic (Hill) Equations, supplied by IDrug GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+%E2%88%92+response+curve+fit+(four+parameters)+using+graphpad+prism/logistic++hill++equations/10__1213_slash_ane__0b013e318254273e-39-6-11
Average 90 stars, based on 1 article reviews
logistic (hill) equations - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
chemical compound  (Selleck Chemicals)
96
Selleck Chemicals chemical compound
Figure 1. <t>MLH1</t> Deficiency Activates Innate Immune Signaling Pathway (A) Detection of cytosolic DNA in WT, Mlh1/ 4T1, and Mlh1-rescued (Rescd) 4T1 cells treated with or without IR, as indicated. DNA was detected using the PicoGreen fluorescence dye selectively binding dsDNA. Arrows point to cytosolic DNA. The scale bars are 10 mm. (B) Percentage of cells displaying cytosolic DNA with and without IR treatment. (C) Western blot analysis showing prolonged gH2AX in Mlh1/, but not in WT and Mlh1-rescued 4T1 cells after IR treatment. (D) Quantification of relative gH2AX levels in various 4T1 cells. (E) Increased production of cGAMP in Mlh1/ 4T1 cells. (F) Western blots showing enhanced phosphorylation of STING (pSTING) and STAT1 (pSTAT1) induced by IR in Mlh1/ cells. (G and H) Quantification of relative levels of pSTING (G) and pSTAT1 (H). (I) qRT-PCR analysis showing increased production of Isg15 in Mlh1/ cells. (J and K) Western blots (J) and qRT-PCR (K) showing that immune signaling induced by MLH1 deficiency depends on cGAS. When present, ‘‘’’ indicates untreated cells. Data represent the mean ± SEM of three independent experiments (B, D, G, and H) or three replicates (E, I, and K). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S1.
Chemical Compound, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+%E2%88%92+response+curve+fit+(four+parameters)+using+graphpad+prism/Compound/10__7554_slash_elife__48469-222-121-125
Average 96 stars, based on 1 article reviews
chemical compound - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier
c57bl  (ATCC)
99
ATCC c57bl
Figure 1. <t>MLH1</t> Deficiency Activates Innate Immune Signaling Pathway (A) Detection of cytosolic DNA in WT, Mlh1/ 4T1, and Mlh1-rescued (Rescd) 4T1 cells treated with or without IR, as indicated. DNA was detected using the PicoGreen fluorescence dye selectively binding dsDNA. Arrows point to cytosolic DNA. The scale bars are 10 mm. (B) Percentage of cells displaying cytosolic DNA with and without IR treatment. (C) Western blot analysis showing prolonged gH2AX in Mlh1/, but not in WT and Mlh1-rescued 4T1 cells after IR treatment. (D) Quantification of relative gH2AX levels in various 4T1 cells. (E) Increased production of cGAMP in Mlh1/ 4T1 cells. (F) Western blots showing enhanced phosphorylation of STING (pSTING) and STAT1 (pSTAT1) induced by IR in Mlh1/ cells. (G and H) Quantification of relative levels of pSTING (G) and pSTAT1 (H). (I) qRT-PCR analysis showing increased production of Isg15 in Mlh1/ cells. (J and K) Western blots (J) and qRT-PCR (K) showing that immune signaling induced by MLH1 deficiency depends on cGAS. When present, ‘‘’’ indicates untreated cells. Data represent the mean ± SEM of three independent experiments (B, D, G, and H) or three replicates (E, I, and K). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S1.
C57bl, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+%E2%88%92+response+curve+fit+(four+parameters)+using+graphpad+prism/C57BL%2F6/pm40530418-248-91-85
Average 99 stars, based on 1 article reviews
c57bl - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
isolated enzyme  (Merck KGaA)
90
Merck KGaA isolated enzyme
Figure 1. <t>MLH1</t> Deficiency Activates Innate Immune Signaling Pathway (A) Detection of cytosolic DNA in WT, Mlh1/ 4T1, and Mlh1-rescued (Rescd) 4T1 cells treated with or without IR, as indicated. DNA was detected using the PicoGreen fluorescence dye selectively binding dsDNA. Arrows point to cytosolic DNA. The scale bars are 10 mm. (B) Percentage of cells displaying cytosolic DNA with and without IR treatment. (C) Western blot analysis showing prolonged gH2AX in Mlh1/, but not in WT and Mlh1-rescued 4T1 cells after IR treatment. (D) Quantification of relative gH2AX levels in various 4T1 cells. (E) Increased production of cGAMP in Mlh1/ 4T1 cells. (F) Western blots showing enhanced phosphorylation of STING (pSTING) and STAT1 (pSTAT1) induced by IR in Mlh1/ cells. (G and H) Quantification of relative levels of pSTING (G) and pSTAT1 (H). (I) qRT-PCR analysis showing increased production of Isg15 in Mlh1/ cells. (J and K) Western blots (J) and qRT-PCR (K) showing that immune signaling induced by MLH1 deficiency depends on cGAS. When present, ‘‘’’ indicates untreated cells. Data represent the mean ± SEM of three independent experiments (B, D, G, and H) or three replicates (E, I, and K). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S1.
Isolated Enzyme, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+%E2%88%92+response+curve+fit+(four+parameters)+using+graphpad+prism/isolated+enzyme/pmc12034677-87-21-22
Average 90 stars, based on 1 article reviews
isolated enzyme - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
rlf-a  (Emergent BioSolutions Inc)
90
Emergent BioSolutions Inc rlf-a
Figure 1. <t>MLH1</t> Deficiency Activates Innate Immune Signaling Pathway (A) Detection of cytosolic DNA in WT, Mlh1/ 4T1, and Mlh1-rescued (Rescd) 4T1 cells treated with or without IR, as indicated. DNA was detected using the PicoGreen fluorescence dye selectively binding dsDNA. Arrows point to cytosolic DNA. The scale bars are 10 mm. (B) Percentage of cells displaying cytosolic DNA with and without IR treatment. (C) Western blot analysis showing prolonged gH2AX in Mlh1/, but not in WT and Mlh1-rescued 4T1 cells after IR treatment. (D) Quantification of relative gH2AX levels in various 4T1 cells. (E) Increased production of cGAMP in Mlh1/ 4T1 cells. (F) Western blots showing enhanced phosphorylation of STING (pSTING) and STAT1 (pSTAT1) induced by IR in Mlh1/ cells. (G and H) Quantification of relative levels of pSTING (G) and pSTAT1 (H). (I) qRT-PCR analysis showing increased production of Isg15 in Mlh1/ cells. (J and K) Western blots (J) and qRT-PCR (K) showing that immune signaling induced by MLH1 deficiency depends on cGAS. When present, ‘‘’’ indicates untreated cells. Data represent the mean ± SEM of three independent experiments (B, D, G, and H) or three replicates (E, I, and K). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S1.
Rlf A, supplied by Emergent BioSolutions Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+%E2%88%92+response+curve+fit+(four+parameters)+using+graphpad+prism/rlf+hma+e/pmc03697443-243-154-175
Average 90 stars, based on 1 article reviews
rlf-a - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Figure 1. MLH1 Deficiency Activates Innate Immune Signaling Pathway (A) Detection of cytosolic DNA in WT, Mlh1/ 4T1, and Mlh1-rescued (Rescd) 4T1 cells treated with or without IR, as indicated. DNA was detected using the PicoGreen fluorescence dye selectively binding dsDNA. Arrows point to cytosolic DNA. The scale bars are 10 mm. (B) Percentage of cells displaying cytosolic DNA with and without IR treatment. (C) Western blot analysis showing prolonged gH2AX in Mlh1/, but not in WT and Mlh1-rescued 4T1 cells after IR treatment. (D) Quantification of relative gH2AX levels in various 4T1 cells. (E) Increased production of cGAMP in Mlh1/ 4T1 cells. (F) Western blots showing enhanced phosphorylation of STING (pSTING) and STAT1 (pSTAT1) induced by IR in Mlh1/ cells. (G and H) Quantification of relative levels of pSTING (G) and pSTAT1 (H). (I) qRT-PCR analysis showing increased production of Isg15 in Mlh1/ cells. (J and K) Western blots (J) and qRT-PCR (K) showing that immune signaling induced by MLH1 deficiency depends on cGAS. When present, ‘‘’’ indicates untreated cells. Data represent the mean ± SEM of three independent experiments (B, D, G, and H) or three replicates (E, I, and K). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S1.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 1. MLH1 Deficiency Activates Innate Immune Signaling Pathway (A) Detection of cytosolic DNA in WT, Mlh1/ 4T1, and Mlh1-rescued (Rescd) 4T1 cells treated with or without IR, as indicated. DNA was detected using the PicoGreen fluorescence dye selectively binding dsDNA. Arrows point to cytosolic DNA. The scale bars are 10 mm. (B) Percentage of cells displaying cytosolic DNA with and without IR treatment. (C) Western blot analysis showing prolonged gH2AX in Mlh1/, but not in WT and Mlh1-rescued 4T1 cells after IR treatment. (D) Quantification of relative gH2AX levels in various 4T1 cells. (E) Increased production of cGAMP in Mlh1/ 4T1 cells. (F) Western blots showing enhanced phosphorylation of STING (pSTING) and STAT1 (pSTAT1) induced by IR in Mlh1/ cells. (G and H) Quantification of relative levels of pSTING (G) and pSTAT1 (H). (I) qRT-PCR analysis showing increased production of Isg15 in Mlh1/ cells. (J and K) Western blots (J) and qRT-PCR (K) showing that immune signaling induced by MLH1 deficiency depends on cGAS. When present, ‘‘’’ indicates untreated cells. Data represent the mean ± SEM of three independent experiments (B, D, G, and H) or three replicates (E, I, and K). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Binding Assay, Western Blot, Phospho-proteomics, Quantitative RT-PCR

Figure 2. Exo1 is Essential for Innate Sensing Signaling in Mlh1–/– 4T1 Cells (A) Depletion of Exo1 reduces cytosolic DNA accumulation in Mlh1/ cells regardless of IR treatment. (B) Western blots showing reduced DNA breaks and pSTAT1 when Exo1 was depleted from Mlh1/ cells. A non-specific band detected by an Exo1 antibody is indicated by an asterisk. (C) Quantification of the relative gH2AX levels in Mlh1 knockout and Mlh1-Exo1 double-knockout (Dbl KO) cells. (D) Western blots showing that Exo1 knockout abolishes IR-induced STING activation. (E) Quantification of relative pSTING levels in Mlh1- knockout and Mlh1-Exo1 Dbl KO cells. (F) qRT-PCR analysis showing that Exo1 depletion suppressed expression of Isg15. Data represent the mean ± SEM of three inde- pendent experiments (A, C, and E) or three repli- cates (F). p values were calculated using one-way ANOVA. ****p < 0.0001. See also Figure S2.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 2. Exo1 is Essential for Innate Sensing Signaling in Mlh1–/– 4T1 Cells (A) Depletion of Exo1 reduces cytosolic DNA accumulation in Mlh1/ cells regardless of IR treatment. (B) Western blots showing reduced DNA breaks and pSTAT1 when Exo1 was depleted from Mlh1/ cells. A non-specific band detected by an Exo1 antibody is indicated by an asterisk. (C) Quantification of the relative gH2AX levels in Mlh1 knockout and Mlh1-Exo1 double-knockout (Dbl KO) cells. (D) Western blots showing that Exo1 knockout abolishes IR-induced STING activation. (E) Quantification of relative pSTING levels in Mlh1- knockout and Mlh1-Exo1 Dbl KO cells. (F) qRT-PCR analysis showing that Exo1 depletion suppressed expression of Isg15. Data represent the mean ± SEM of three inde- pendent experiments (A, C, and E) or three repli- cates (F). p values were calculated using one-way ANOVA. ****p < 0.0001. See also Figure S2.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Western Blot, Knock-Out, Double Knockout, Activation Assay, Quantitative RT-PCR, Expressing

Figure 3. MutLa Regulates Exo1 Nuclease Activity (A) Diagram of major functional domains in Exo1. (B) Co-immunoprecipitation/western blot analysis of MutLa interactions with WT and mutant Exo1 (right) using purified proteins (left). (C) Southern blot analysis determining the impact of the MutLa–Exo1 interaction on mismatch-provoked excision in a purified MMR system. The excision products were digested with SspI and processed for Southern blot analysis, as described in STAR Methods. Schematic representation of the 50 G-T heteroduplex after SspI digestion is shown on the right side of the gel. Positions of the nick and mismatch (red asterisk) are 544 bp and 416 bp away, respectively, from the bottom SspI site. Red bar indicates the 32P-labeled oligonucleotide probe, which is complementary to the nicked strand near the bottom SspI site. Red bracket shows mismatch-provoked excision products terminated upon mismatch removal in reactions with WT Exo1 but not in those with Exo1-FF-AA. (D) In vitro end-resection assay to determine the impact of the MutLa-Exo1 interaction on Exo1-catalyzed resection using purified proteins and a linearized 2.7-kb pUC19 plasmid DNA. MutLa concentration was 1 pmol (lower) or 4 pmol (higher). (E) Percentage of end-resection product II shown in (D) in three independent assays. (F) In vitro end-resection assay to determine the role of RPA in Exo1-catalyzed resection. The MutLa concentrations used in titration were 1 pmol, 2 pmol and 4 pmol. (G) Principle of in vivo end-resection assay. (H) qPCR analysis determining the amount of ssDNA generated at a specific DBS site (AsiSI) in WT and MLH1/ U2OS cells. Data represent the mean ± SEM of three independent experiments (E) or three replicates (H). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 3. MutLa Regulates Exo1 Nuclease Activity (A) Diagram of major functional domains in Exo1. (B) Co-immunoprecipitation/western blot analysis of MutLa interactions with WT and mutant Exo1 (right) using purified proteins (left). (C) Southern blot analysis determining the impact of the MutLa–Exo1 interaction on mismatch-provoked excision in a purified MMR system. The excision products were digested with SspI and processed for Southern blot analysis, as described in STAR Methods. Schematic representation of the 50 G-T heteroduplex after SspI digestion is shown on the right side of the gel. Positions of the nick and mismatch (red asterisk) are 544 bp and 416 bp away, respectively, from the bottom SspI site. Red bar indicates the 32P-labeled oligonucleotide probe, which is complementary to the nicked strand near the bottom SspI site. Red bracket shows mismatch-provoked excision products terminated upon mismatch removal in reactions with WT Exo1 but not in those with Exo1-FF-AA. (D) In vitro end-resection assay to determine the impact of the MutLa-Exo1 interaction on Exo1-catalyzed resection using purified proteins and a linearized 2.7-kb pUC19 plasmid DNA. MutLa concentration was 1 pmol (lower) or 4 pmol (higher). (E) Percentage of end-resection product II shown in (D) in three independent assays. (F) In vitro end-resection assay to determine the role of RPA in Exo1-catalyzed resection. The MutLa concentrations used in titration were 1 pmol, 2 pmol and 4 pmol. (G) Principle of in vivo end-resection assay. (H) qPCR analysis determining the amount of ssDNA generated at a specific DBS site (AsiSI) in WT and MLH1/ U2OS cells. Data represent the mean ± SEM of three independent experiments (E) or three replicates (H). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Activity Assay, Functional Assay, Immunoprecipitation, Western Blot, Mutagenesis, Southern Blot, Labeling, In Vitro, Resection Assay, Plasmid Preparation, Concentration Assay, Titration, In Vivo, Generated

Figure 4. Exo1 Recruitment, Abundance, and Stability in MLH1–/– Cells (A) Live cell imaging showing real-time recruitment and retention dynamics of GFP-tagged Exo1 after laser microirradiation in WT and MLH1/ HeLa cells. The scale bars are 5 mm. (B) Quantification of GFP-tagged Exo1 levels from the indicated number of cells. (C) Western blots showing whole cell lysate (WCL) and chromatin-bound levels of Exo1 and phos- phorylated Exo1 (pExo1) in WT and MLH1/ HeLa cells. (D) Quantification of relative total Exo1 levels in WT and MLH1/ HeLa cells. (E) Western blots showing WCL levels of Exo1 in WT and MLH1/ U2OS cells. (F) RNA-sequencing data from the TCGA database showing significantly higher Exo1 expression in dMLH1 tumors than in MSS tumors. (G) Quantification of relative pExo1 levels in WCL (upper) and on chromatin (lower) in WT and MLH1/ HeLa cells. Data represent the mean ± SEM of three inde- pendent experiments. p values were calculated using one-way ANOVA. ****p < 0.0001. See also Figure S3.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 4. Exo1 Recruitment, Abundance, and Stability in MLH1–/– Cells (A) Live cell imaging showing real-time recruitment and retention dynamics of GFP-tagged Exo1 after laser microirradiation in WT and MLH1/ HeLa cells. The scale bars are 5 mm. (B) Quantification of GFP-tagged Exo1 levels from the indicated number of cells. (C) Western blots showing whole cell lysate (WCL) and chromatin-bound levels of Exo1 and phos- phorylated Exo1 (pExo1) in WT and MLH1/ HeLa cells. (D) Quantification of relative total Exo1 levels in WT and MLH1/ HeLa cells. (E) Western blots showing WCL levels of Exo1 in WT and MLH1/ U2OS cells. (F) RNA-sequencing data from the TCGA database showing significantly higher Exo1 expression in dMLH1 tumors than in MSS tumors. (G) Quantification of relative pExo1 levels in WCL (upper) and on chromatin (lower) in WT and MLH1/ HeLa cells. Data represent the mean ± SEM of three inde- pendent experiments. p values were calculated using one-way ANOVA. ****p < 0.0001. See also Figure S3.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Live Cell Imaging, Western Blot, RNA Sequencing, Expressing

Figure 5. RPA Exhaustion and Aberrant Resection Intermediates in MLH1–/– Cells (A) Microscope imaging showing BrdU incorporation by DNA polymerase using hype-resection-generated unprotected RPA as a template for DNA synthesis in the RPA exhaustion assay. ssDNA binding by phosphorylated RPA (pRPA) is also shown. (B and C) Quantification of BrdU foci/cell (B) and percentage of cells exhibiting BrdU foci (C) in WT and MLH1/ U2OS cells. (D) Quantification of pRPA foci per cell. (E) Western blots detecting pRPA and its association with DNA break marker gH2AX in the indicated cells before and after IR. (F) Quantification of relative pRPA levels shown in (E), with three independent assays. (G) Immunofluorescence confocal analysis showing large RPA foci in HeLa MLH1/ cells. (H) Quantification and comparison of the percentage of WT and MLH1/ cells displaying RPA foci. (I) Immunofluorescence confocal analysis showing large Rad51 foci in MLH1/ HeLa cells. (J) Quantification of RAD51 foci/nucleus in various HeLa cells, as indicated. (K) Immunofluorescence confocal analysis showing large Rad51 foci in HCT116 and MLH1-rescued HCT116 cells. Data represent the mean ± SEM of three independent experiments (C, F, and H) or the indicated number of cells (B, D, and J). p values were calculated using one- way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 5. RPA Exhaustion and Aberrant Resection Intermediates in MLH1–/– Cells (A) Microscope imaging showing BrdU incorporation by DNA polymerase using hype-resection-generated unprotected RPA as a template for DNA synthesis in the RPA exhaustion assay. ssDNA binding by phosphorylated RPA (pRPA) is also shown. (B and C) Quantification of BrdU foci/cell (B) and percentage of cells exhibiting BrdU foci (C) in WT and MLH1/ U2OS cells. (D) Quantification of pRPA foci per cell. (E) Western blots detecting pRPA and its association with DNA break marker gH2AX in the indicated cells before and after IR. (F) Quantification of relative pRPA levels shown in (E), with three independent assays. (G) Immunofluorescence confocal analysis showing large RPA foci in HeLa MLH1/ cells. (H) Quantification and comparison of the percentage of WT and MLH1/ cells displaying RPA foci. (I) Immunofluorescence confocal analysis showing large Rad51 foci in MLH1/ HeLa cells. (J) Quantification of RAD51 foci/nucleus in various HeLa cells, as indicated. (K) Immunofluorescence confocal analysis showing large Rad51 foci in HCT116 and MLH1-rescued HCT116 cells. Data represent the mean ± SEM of three independent experiments (C, F, and H) or the indicated number of cells (B, D, and J). p values were calculated using one- way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Microscopy, Imaging, BrdU Incorporation Assay, Generated, DNA Synthesis, Binding Assay, Western Blot, Marker, Comparison

Figure 6. Chromosomal Abnormalities in MLH1–/– Cells (A–D) Chromosomal spreading analysis to deter- mine metaphase chromosomal breaks and other aberrations in 4T1 cells (A and C) and Mlh1/ 4T1 cells (B and D) with (C and D) and without (A and B) IR treatment. Chromosome breaks are indicated by green arrows while unresolved chromosomes are indicated by blue arrows. (E) Percentage of WT and Mlh1/ 4T1 cells con- taining the indicated number of chromosome ab- normalities. (F and G) Average number of chromosomal ab- normalities in WT and Mlh1/ 4T1 (F) and HeLa (G) cells. (H) Average number of chromosomal abnormal- ities in HCT116 and MLH1-rescued HCT116 cells. ***p < 0.001; ****p < 0.0001.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 6. Chromosomal Abnormalities in MLH1–/– Cells (A–D) Chromosomal spreading analysis to deter- mine metaphase chromosomal breaks and other aberrations in 4T1 cells (A and C) and Mlh1/ 4T1 cells (B and D) with (C and D) and without (A and B) IR treatment. Chromosome breaks are indicated by green arrows while unresolved chromosomes are indicated by blue arrows. (E) Percentage of WT and Mlh1/ 4T1 cells con- taining the indicated number of chromosome ab- normalities. (F and G) Average number of chromosomal ab- normalities in WT and Mlh1/ 4T1 (F) and HeLa (G) cells. (H) Average number of chromosomal abnormal- ities in HCT116 and MLH1-rescued HCT116 cells. ***p < 0.001; ****p < 0.0001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques:

Figure 7. Model for MLH1–/–-Mediated cGAS Activation and Immunotherapy MutLa (MLH1-PMS2) properly terminates Exo1- catalyzed end resection, which facilitates DSB repair by HR (left). However, depleting MLH1 de- prives cells of MutLa, allowing Exo1 to conduct uncontrolled excision. This hyper-resection gen- erates a large quantity of ssDNA that exhausts the RPA pool, leaving the ssDNA chain unprotected. The unprotected ssDNA can be digested or nicked by various nucleases in the nucleus, which leads to abnormal recombination intermediates and chro- mosome breaks. The latter can trigger cells to degrade a part or all of the damaged chromosome to release nuclear DNA into the cytoplasm, acti- vating the cGAS-STING pathway and the down- stream immune responses. Together with the large number of neoantigens generated from mutations caused by MLH1 deficiency, the immune signaling activated by Exo1 hyper-resection facilitates immunotherapy.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 7. Model for MLH1–/–-Mediated cGAS Activation and Immunotherapy MutLa (MLH1-PMS2) properly terminates Exo1- catalyzed end resection, which facilitates DSB repair by HR (left). However, depleting MLH1 de- prives cells of MutLa, allowing Exo1 to conduct uncontrolled excision. This hyper-resection gen- erates a large quantity of ssDNA that exhausts the RPA pool, leaving the ssDNA chain unprotected. The unprotected ssDNA can be digested or nicked by various nucleases in the nucleus, which leads to abnormal recombination intermediates and chro- mosome breaks. The latter can trigger cells to degrade a part or all of the damaged chromosome to release nuclear DNA into the cytoplasm, acti- vating the cGAS-STING pathway and the down- stream immune responses. Together with the large number of neoantigens generated from mutations caused by MLH1 deficiency, the immune signaling activated by Exo1 hyper-resection facilitates immunotherapy.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Activation Assay, Immunopeptidomics, Generated

KEY RESOURCES TABLE

Journal: Current biology : CB

Article Title: A conserved PDZ Binding Motif in aPKC interacts with Par-3 and mediates cortical polarity

doi: 10.1016/j.cub.2019.12.055

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Doe Lab N/A D. melanogaster: elav-Gal4, UAS-mCD8:GFP, hs:flp; FRT-G13, tubPGal80 Bloomington Drosophila Stock Center RRID:BDSC_5145 Oligonucleotides Recombinant DNA pCMV mammalian expression plasmid ThermoFisher 10586014 pMal C4X bacterial expression plasmid Addgene 75288 pGex 4Ti bacterial expression plasmid Amersham 27458001 pUASTattB fly cloning and transformation plasmid Addgene EF362409.1 Software and Algorithms ImageJ GraphPad Other PD10 Desalting columns 95017–001 VivaSpin 20 sample concentrators MWCO 30kD VWR 95056–130 VivaSpin 20 sample concentrators MWCO 10kD VWR 95056–128 Shaker Flasks – 125mL VWR 89095–258 Open in a separate window KEY RESOURCES TABLE Par-3 and Par-6/aPKC interact through a PDZ2 – PDZ Binding Motif interaction The Par-3 PDZ2 interaction with the aPKC PBM is conserved across metazoan The aPKC PBM is required for cortical polarity in Drosophila neuroblasts

Techniques: Diagnostic Assay, Recombinant, Construct, Variant Assay, Expressing, Blocking Assay, Plasmid Preparation, Clone Assay, Transformation Assay, Software

Figure 1. MLH1 Deficiency Activates Innate Immune Signaling Pathway (A) Detection of cytosolic DNA in WT, Mlh1/ 4T1, and Mlh1-rescued (Rescd) 4T1 cells treated with or without IR, as indicated. DNA was detected using the PicoGreen fluorescence dye selectively binding dsDNA. Arrows point to cytosolic DNA. The scale bars are 10 mm. (B) Percentage of cells displaying cytosolic DNA with and without IR treatment. (C) Western blot analysis showing prolonged gH2AX in Mlh1/, but not in WT and Mlh1-rescued 4T1 cells after IR treatment. (D) Quantification of relative gH2AX levels in various 4T1 cells. (E) Increased production of cGAMP in Mlh1/ 4T1 cells. (F) Western blots showing enhanced phosphorylation of STING (pSTING) and STAT1 (pSTAT1) induced by IR in Mlh1/ cells. (G and H) Quantification of relative levels of pSTING (G) and pSTAT1 (H). (I) qRT-PCR analysis showing increased production of Isg15 in Mlh1/ cells. (J and K) Western blots (J) and qRT-PCR (K) showing that immune signaling induced by MLH1 deficiency depends on cGAS. When present, ‘‘’’ indicates untreated cells. Data represent the mean ± SEM of three independent experiments (B, D, G, and H) or three replicates (E, I, and K). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S1.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 1. MLH1 Deficiency Activates Innate Immune Signaling Pathway (A) Detection of cytosolic DNA in WT, Mlh1/ 4T1, and Mlh1-rescued (Rescd) 4T1 cells treated with or without IR, as indicated. DNA was detected using the PicoGreen fluorescence dye selectively binding dsDNA. Arrows point to cytosolic DNA. The scale bars are 10 mm. (B) Percentage of cells displaying cytosolic DNA with and without IR treatment. (C) Western blot analysis showing prolonged gH2AX in Mlh1/, but not in WT and Mlh1-rescued 4T1 cells after IR treatment. (D) Quantification of relative gH2AX levels in various 4T1 cells. (E) Increased production of cGAMP in Mlh1/ 4T1 cells. (F) Western blots showing enhanced phosphorylation of STING (pSTING) and STAT1 (pSTAT1) induced by IR in Mlh1/ cells. (G and H) Quantification of relative levels of pSTING (G) and pSTAT1 (H). (I) qRT-PCR analysis showing increased production of Isg15 in Mlh1/ cells. (J and K) Western blots (J) and qRT-PCR (K) showing that immune signaling induced by MLH1 deficiency depends on cGAS. When present, ‘‘’’ indicates untreated cells. Data represent the mean ± SEM of three independent experiments (B, D, G, and H) or three replicates (E, I, and K). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Binding Assay, Western Blot, Phospho-proteomics, Quantitative RT-PCR

Figure 2. Exo1 is Essential for Innate Sensing Signaling in Mlh1–/– 4T1 Cells (A) Depletion of Exo1 reduces cytosolic DNA accumulation in Mlh1/ cells regardless of IR treatment. (B) Western blots showing reduced DNA breaks and pSTAT1 when Exo1 was depleted from Mlh1/ cells. A non-specific band detected by an Exo1 antibody is indicated by an asterisk. (C) Quantification of the relative gH2AX levels in Mlh1 knockout and Mlh1-Exo1 double-knockout (Dbl KO) cells. (D) Western blots showing that Exo1 knockout abolishes IR-induced STING activation. (E) Quantification of relative pSTING levels in Mlh1- knockout and Mlh1-Exo1 Dbl KO cells. (F) qRT-PCR analysis showing that Exo1 depletion suppressed expression of Isg15. Data represent the mean ± SEM of three inde- pendent experiments (A, C, and E) or three repli- cates (F). p values were calculated using one-way ANOVA. ****p < 0.0001. See also Figure S2.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 2. Exo1 is Essential for Innate Sensing Signaling in Mlh1–/– 4T1 Cells (A) Depletion of Exo1 reduces cytosolic DNA accumulation in Mlh1/ cells regardless of IR treatment. (B) Western blots showing reduced DNA breaks and pSTAT1 when Exo1 was depleted from Mlh1/ cells. A non-specific band detected by an Exo1 antibody is indicated by an asterisk. (C) Quantification of the relative gH2AX levels in Mlh1 knockout and Mlh1-Exo1 double-knockout (Dbl KO) cells. (D) Western blots showing that Exo1 knockout abolishes IR-induced STING activation. (E) Quantification of relative pSTING levels in Mlh1- knockout and Mlh1-Exo1 Dbl KO cells. (F) qRT-PCR analysis showing that Exo1 depletion suppressed expression of Isg15. Data represent the mean ± SEM of three inde- pendent experiments (A, C, and E) or three repli- cates (F). p values were calculated using one-way ANOVA. ****p < 0.0001. See also Figure S2.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Western Blot, Knock-Out, Double Knockout, Activation Assay, Quantitative RT-PCR, Expressing

Figure 3. MutLa Regulates Exo1 Nuclease Activity (A) Diagram of major functional domains in Exo1. (B) Co-immunoprecipitation/western blot analysis of MutLa interactions with WT and mutant Exo1 (right) using purified proteins (left). (C) Southern blot analysis determining the impact of the MutLa–Exo1 interaction on mismatch-provoked excision in a purified MMR system. The excision products were digested with SspI and processed for Southern blot analysis, as described in STAR Methods. Schematic representation of the 50 G-T heteroduplex after SspI digestion is shown on the right side of the gel. Positions of the nick and mismatch (red asterisk) are 544 bp and 416 bp away, respectively, from the bottom SspI site. Red bar indicates the 32P-labeled oligonucleotide probe, which is complementary to the nicked strand near the bottom SspI site. Red bracket shows mismatch-provoked excision products terminated upon mismatch removal in reactions with WT Exo1 but not in those with Exo1-FF-AA. (D) In vitro end-resection assay to determine the impact of the MutLa-Exo1 interaction on Exo1-catalyzed resection using purified proteins and a linearized 2.7-kb pUC19 plasmid DNA. MutLa concentration was 1 pmol (lower) or 4 pmol (higher). (E) Percentage of end-resection product II shown in (D) in three independent assays. (F) In vitro end-resection assay to determine the role of RPA in Exo1-catalyzed resection. The MutLa concentrations used in titration were 1 pmol, 2 pmol and 4 pmol. (G) Principle of in vivo end-resection assay. (H) qPCR analysis determining the amount of ssDNA generated at a specific DBS site (AsiSI) in WT and MLH1/ U2OS cells. Data represent the mean ± SEM of three independent experiments (E) or three replicates (H). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 3. MutLa Regulates Exo1 Nuclease Activity (A) Diagram of major functional domains in Exo1. (B) Co-immunoprecipitation/western blot analysis of MutLa interactions with WT and mutant Exo1 (right) using purified proteins (left). (C) Southern blot analysis determining the impact of the MutLa–Exo1 interaction on mismatch-provoked excision in a purified MMR system. The excision products were digested with SspI and processed for Southern blot analysis, as described in STAR Methods. Schematic representation of the 50 G-T heteroduplex after SspI digestion is shown on the right side of the gel. Positions of the nick and mismatch (red asterisk) are 544 bp and 416 bp away, respectively, from the bottom SspI site. Red bar indicates the 32P-labeled oligonucleotide probe, which is complementary to the nicked strand near the bottom SspI site. Red bracket shows mismatch-provoked excision products terminated upon mismatch removal in reactions with WT Exo1 but not in those with Exo1-FF-AA. (D) In vitro end-resection assay to determine the impact of the MutLa-Exo1 interaction on Exo1-catalyzed resection using purified proteins and a linearized 2.7-kb pUC19 plasmid DNA. MutLa concentration was 1 pmol (lower) or 4 pmol (higher). (E) Percentage of end-resection product II shown in (D) in three independent assays. (F) In vitro end-resection assay to determine the role of RPA in Exo1-catalyzed resection. The MutLa concentrations used in titration were 1 pmol, 2 pmol and 4 pmol. (G) Principle of in vivo end-resection assay. (H) qPCR analysis determining the amount of ssDNA generated at a specific DBS site (AsiSI) in WT and MLH1/ U2OS cells. Data represent the mean ± SEM of three independent experiments (E) or three replicates (H). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Activity Assay, Functional Assay, Immunoprecipitation, Western Blot, Mutagenesis, Southern Blot, Labeling, In Vitro, Resection Assay, Plasmid Preparation, Concentration Assay, Titration, In Vivo, Generated

Figure 4. Exo1 Recruitment, Abundance, and Stability in MLH1–/– Cells (A) Live cell imaging showing real-time recruitment and retention dynamics of GFP-tagged Exo1 after laser microirradiation in WT and MLH1/ HeLa cells. The scale bars are 5 mm. (B) Quantification of GFP-tagged Exo1 levels from the indicated number of cells. (C) Western blots showing whole cell lysate (WCL) and chromatin-bound levels of Exo1 and phos- phorylated Exo1 (pExo1) in WT and MLH1/ HeLa cells. (D) Quantification of relative total Exo1 levels in WT and MLH1/ HeLa cells. (E) Western blots showing WCL levels of Exo1 in WT and MLH1/ U2OS cells. (F) RNA-sequencing data from the TCGA database showing significantly higher Exo1 expression in dMLH1 tumors than in MSS tumors. (G) Quantification of relative pExo1 levels in WCL (upper) and on chromatin (lower) in WT and MLH1/ HeLa cells. Data represent the mean ± SEM of three inde- pendent experiments. p values were calculated using one-way ANOVA. ****p < 0.0001. See also Figure S3.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 4. Exo1 Recruitment, Abundance, and Stability in MLH1–/– Cells (A) Live cell imaging showing real-time recruitment and retention dynamics of GFP-tagged Exo1 after laser microirradiation in WT and MLH1/ HeLa cells. The scale bars are 5 mm. (B) Quantification of GFP-tagged Exo1 levels from the indicated number of cells. (C) Western blots showing whole cell lysate (WCL) and chromatin-bound levels of Exo1 and phos- phorylated Exo1 (pExo1) in WT and MLH1/ HeLa cells. (D) Quantification of relative total Exo1 levels in WT and MLH1/ HeLa cells. (E) Western blots showing WCL levels of Exo1 in WT and MLH1/ U2OS cells. (F) RNA-sequencing data from the TCGA database showing significantly higher Exo1 expression in dMLH1 tumors than in MSS tumors. (G) Quantification of relative pExo1 levels in WCL (upper) and on chromatin (lower) in WT and MLH1/ HeLa cells. Data represent the mean ± SEM of three inde- pendent experiments. p values were calculated using one-way ANOVA. ****p < 0.0001. See also Figure S3.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Live Cell Imaging, Western Blot, RNA Sequencing, Expressing

Figure 5. RPA Exhaustion and Aberrant Resection Intermediates in MLH1–/– Cells (A) Microscope imaging showing BrdU incorporation by DNA polymerase using hype-resection-generated unprotected RPA as a template for DNA synthesis in the RPA exhaustion assay. ssDNA binding by phosphorylated RPA (pRPA) is also shown. (B and C) Quantification of BrdU foci/cell (B) and percentage of cells exhibiting BrdU foci (C) in WT and MLH1/ U2OS cells. (D) Quantification of pRPA foci per cell. (E) Western blots detecting pRPA and its association with DNA break marker gH2AX in the indicated cells before and after IR. (F) Quantification of relative pRPA levels shown in (E), with three independent assays. (G) Immunofluorescence confocal analysis showing large RPA foci in HeLa MLH1/ cells. (H) Quantification and comparison of the percentage of WT and MLH1/ cells displaying RPA foci. (I) Immunofluorescence confocal analysis showing large Rad51 foci in MLH1/ HeLa cells. (J) Quantification of RAD51 foci/nucleus in various HeLa cells, as indicated. (K) Immunofluorescence confocal analysis showing large Rad51 foci in HCT116 and MLH1-rescued HCT116 cells. Data represent the mean ± SEM of three independent experiments (C, F, and H) or the indicated number of cells (B, D, and J). p values were calculated using one- way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 5. RPA Exhaustion and Aberrant Resection Intermediates in MLH1–/– Cells (A) Microscope imaging showing BrdU incorporation by DNA polymerase using hype-resection-generated unprotected RPA as a template for DNA synthesis in the RPA exhaustion assay. ssDNA binding by phosphorylated RPA (pRPA) is also shown. (B and C) Quantification of BrdU foci/cell (B) and percentage of cells exhibiting BrdU foci (C) in WT and MLH1/ U2OS cells. (D) Quantification of pRPA foci per cell. (E) Western blots detecting pRPA and its association with DNA break marker gH2AX in the indicated cells before and after IR. (F) Quantification of relative pRPA levels shown in (E), with three independent assays. (G) Immunofluorescence confocal analysis showing large RPA foci in HeLa MLH1/ cells. (H) Quantification and comparison of the percentage of WT and MLH1/ cells displaying RPA foci. (I) Immunofluorescence confocal analysis showing large Rad51 foci in MLH1/ HeLa cells. (J) Quantification of RAD51 foci/nucleus in various HeLa cells, as indicated. (K) Immunofluorescence confocal analysis showing large Rad51 foci in HCT116 and MLH1-rescued HCT116 cells. Data represent the mean ± SEM of three independent experiments (C, F, and H) or the indicated number of cells (B, D, and J). p values were calculated using one- way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Microscopy, Imaging, BrdU Incorporation Assay, Generated, DNA Synthesis, Binding Assay, Western Blot, Marker, Comparison

Figure 6. Chromosomal Abnormalities in MLH1–/– Cells (A–D) Chromosomal spreading analysis to deter- mine metaphase chromosomal breaks and other aberrations in 4T1 cells (A and C) and Mlh1/ 4T1 cells (B and D) with (C and D) and without (A and B) IR treatment. Chromosome breaks are indicated by green arrows while unresolved chromosomes are indicated by blue arrows. (E) Percentage of WT and Mlh1/ 4T1 cells con- taining the indicated number of chromosome ab- normalities. (F and G) Average number of chromosomal ab- normalities in WT and Mlh1/ 4T1 (F) and HeLa (G) cells. (H) Average number of chromosomal abnormal- ities in HCT116 and MLH1-rescued HCT116 cells. ***p < 0.001; ****p < 0.0001.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 6. Chromosomal Abnormalities in MLH1–/– Cells (A–D) Chromosomal spreading analysis to deter- mine metaphase chromosomal breaks and other aberrations in 4T1 cells (A and C) and Mlh1/ 4T1 cells (B and D) with (C and D) and without (A and B) IR treatment. Chromosome breaks are indicated by green arrows while unresolved chromosomes are indicated by blue arrows. (E) Percentage of WT and Mlh1/ 4T1 cells con- taining the indicated number of chromosome ab- normalities. (F and G) Average number of chromosomal ab- normalities in WT and Mlh1/ 4T1 (F) and HeLa (G) cells. (H) Average number of chromosomal abnormal- ities in HCT116 and MLH1-rescued HCT116 cells. ***p < 0.001; ****p < 0.0001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques:

Figure 7. Model for MLH1–/–-Mediated cGAS Activation and Immunotherapy MutLa (MLH1-PMS2) properly terminates Exo1- catalyzed end resection, which facilitates DSB repair by HR (left). However, depleting MLH1 de- prives cells of MutLa, allowing Exo1 to conduct uncontrolled excision. This hyper-resection gen- erates a large quantity of ssDNA that exhausts the RPA pool, leaving the ssDNA chain unprotected. The unprotected ssDNA can be digested or nicked by various nucleases in the nucleus, which leads to abnormal recombination intermediates and chro- mosome breaks. The latter can trigger cells to degrade a part or all of the damaged chromosome to release nuclear DNA into the cytoplasm, acti- vating the cGAS-STING pathway and the down- stream immune responses. Together with the large number of neoantigens generated from mutations caused by MLH1 deficiency, the immune signaling activated by Exo1 hyper-resection facilitates immunotherapy.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 7. Model for MLH1–/–-Mediated cGAS Activation and Immunotherapy MutLa (MLH1-PMS2) properly terminates Exo1- catalyzed end resection, which facilitates DSB repair by HR (left). However, depleting MLH1 de- prives cells of MutLa, allowing Exo1 to conduct uncontrolled excision. This hyper-resection gen- erates a large quantity of ssDNA that exhausts the RPA pool, leaving the ssDNA chain unprotected. The unprotected ssDNA can be digested or nicked by various nucleases in the nucleus, which leads to abnormal recombination intermediates and chro- mosome breaks. The latter can trigger cells to degrade a part or all of the damaged chromosome to release nuclear DNA into the cytoplasm, acti- vating the cGAS-STING pathway and the down- stream immune responses. Together with the large number of neoantigens generated from mutations caused by MLH1 deficiency, the immune signaling activated by Exo1 hyper-resection facilitates immunotherapy.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Activation Assay, Immunopeptidomics, Generated